Publication: Samsun Yöresi Mandalarda Kistik Ekinokokozisin Yaygınlığı, Suşların PZR ve DNA Dizi Analizi İle Tesbiti
| dc.contributor.advisor | Umur, Şinasi | |
| dc.contributor.author | Beyhan, Yunus Emre | |
| dc.date.accessioned | 2020-07-21T21:59:27Z | |
| dc.date.available | 2020-07-21T21:59:27Z | |
| dc.date.issued | 2011 | |
| dc.department | OMÜ, Sağlık Bilimleri Enstitüsü, Parazitoloji (Veteriner) Anabilim Dalı | en_US |
| dc.department | Sağlık Bilimleri Enstitüsü / Parazitoloji (Veterinerlik) Ana Bilim Dalı | |
| dc.description | Tez (doktora) -- Ondokuz Mayıs Üniversitesi, 2011 | en_US |
| dc.description | Libra Kayıt No: 76552 | en_US |
| dc.description.abstract | Echinococcus granulosus larvalarının neden olduğu kistik ekinokokozis hem insanları hem de hayvanları etkileyen dünyadaki en önemli zoonozlardan birisidir. Parazitin ergin şekilleri köpek, kurt, çakal ve diğer kanidelerin ince bağırsaklarında, larva formu ise koyun, keçi, sığır, domuz, insan ve birçok memeli hayvanın iç organlarında bulunmaktadır. E.granulosus türü içerisinde bugüne kadar 10 suş (G1-G10) tanımlanmıştır. Echinococcus cinsi içerisindeki varyasyonlar, parazitin yaşam çemberi, konak özgüllüğü, gelişim hızı, patojenitesi, antijenite ve kemoteropotik ajanlara duyarlılığı, bulaşma dinamikleri, hastalığın epidemiyolojisi ve kontrol yöntemleri üzerinde önemli derecede rol oynamaktadırlar. Bu bakımdan bir bölgedeki baskın suşun ya da suşların belirlenmesi parazitin kontrolü ve eradikasyonu, Echinococcus'a karşı tanı yöntemleri ve aşıların üretilmesi ve ilaçların etkinliği açısından çok önemlidir.Bu çalışma ile Samsun yöresinde mandalarda kistik ekinokokozisin yaygınlığının belirlenmesi, mandalarda bulunan mevcut suşların moleküler tekniklerle varlığının ortaya konması amaçlanmıştır.Mart 2006 ile Haziran 2010 tarihleri arasında Samsun (Merkez, Çarşamba, Terme, Bafra, Ondokuzmayıs) ve Amasya (Suluova)'daki mezbahalara gidilerek kesimi yapılan 60 dişi ve 106 erkek olmak üzere toplam 166 manda incelenmiştir. Kesim sonrası kistik ekinokokozis yönünden muayene edilen mandaların 17 (%10,24)'sinde kist tespit edilmiştir. Bunların sekizinin (%47,06) akciğer, beşinin (%29,41) karaciğer ve dördünün (%23,53) her iki organı enfekte bulunmuştur. Dişilerin 13'ü (%21,66), erkeklerin de dördü (%3,77) enfekte bulunmuştur. Enfeksiyon yaşa göre artmıştır. Gençlerde bu oran %4,38 olarak bulunurken, yaşlılarda ise %37,93 olarak tespit edilmiştir.Enfekte hayvanlardaki E. granulosus suşunu belirlemek amacıyla kistlerden çıkarılan parazite ait parçalardan (protoskoleks ve germinal membran) DNA elde edildikten sonra, cox1 gen bölgeleri ileri JB3 (TTTTTTGGGCATCCTGAGGTTTAT) ve geri JB4.5 (TAAAGAAAGAACATAATGAAAATG) primerleri kullanılarak PZR ile çoğaltılmıştır. Daha sonra bu DNA'lar %1'lik agaroz jel elektroforezde yürütülerek bantlar görüntülenmiştir. Bu örneklere ait PZR ürünleri özel bir firmaya (İontek) gönderilerek çift yönlü DNA dizi analizi yaptırılmış, elde edilen sonuçlar Blast'a girilerek (www.ncbi.nlm.nih.gov/BLAST/) GenBank'taki sonuçlarla karşılaştırılmıştır.Bu çalışmada incelenen mandalardan elde edilen izolatların tümünde evcil koyun suşu olarak bilinen G1 suşu ve varyantlarının bulunduğu görülmüştür.Sonuç olarak; mandalarda G1 suşunun tespit edilmesi, bu hayvanların da insan enfeksiyonları için kaynak oluşturabileceğini göstermektedir. Bu nedenle hastalığın kontrolünde daha etkili stratejilerin geliştirilmesi, bölgesel ve ulusal düzeyde yapılması gerekli olan eradikasyon, aşı ve ilaç geliştirme çalışmaları ve halk sağlığı açısından bu noktanın göz önüne alınmasında yarar bulunmaktadır. | |
| dc.description.abstract | Cystic echinococcosis caused by larvae of the Echinococcus granulosus is affecting both people and animals and it is one of the world?s most important zoonosis. The adult forms of parasite are found dogs, wolves, jackals and other canids small intestine and the larvae forms are found sheep, goats, cattle, pigs, humans and many other mammals internal organs. In total 10 distinct strains (genotypes) of E. granulosus have been described. Variation within the genus Echinococcus plays significant role in life cycle, host specificity, development rate, pathogenity, antigenicity and sensitivity to chemotherapeutic agents, transmission dynamics, epidemiology and control methods. In this respect, in a region to determine the dominant strain or strains is much important for control and eradication of parasites, production diagnostic methods and vaccines against Echinococcus and effectiveness of drugs.In this study, we aim to determine the prevalence of cystic echinococcosis, presence of current strains of buffaloe isolates and contributing to molecular epidemiology.Between March 2006 and June 2010, 166 slaughtering water buffaloes (60 female and 106 male) were examined in Samsun (Centre, Çarşamba, Terme, Bafra, Ondokuzmayıs) and Amasya (Suluova) abattoirs and 17 (%10.24) of them infected with cystic echinococcosis. 8 of buffaloes lungs (47.06%), 5 of thems liver (29.41%) and 4 of thems (23.53%) both lung and livers were found infected. 13 of females (21.66%) and 4 of males (3.77%) were found infected. Infection rate increased by age. This rate was found 4.38% in youngs and 37.93% in olds.After the DNA obtained from parasitic components (protoscolex and germinal layer) which extracted from cysts, cox1 gene regions were amplified with PCR by using forward JB3 (TTTTTTGGGCATCCTGAGGTTTAT) and reverse JB4.5 (TAAAGAAAGAACATAATGAAAATG) primers. Then, bands were visualied with conducting these DNA?s on the %1 agarose electrophresis. PCR product of these samples were done bidirectional DNA sequencing by sending privative company (İontek), our results compared with Genbank results by entering the Blast (www.ncbi.nlm.nih.gov/BLAST/).All isolates obtained from in this study buffaloes were found to have G1 strain and its variants.Consequently, to be determined G1 strain in water buffaloes shows that these animals can be source for human infections. Therefore, this point is taking into consideration in terms of development more effective strategies for control of the disease, eradication, vaccine and drug development studies need to be made in regional and national levels and public health benefits. | en_US |
| dc.format | XVI, 108 y. : şekil ; 30 sm. | en_US |
| dc.identifier.endpage | 130 | |
| dc.identifier.uri | https://tez.yok.gov.tr/UlusalTezMerkezi/TezGoster?key=zqI_ZOq-b18GC2rT9c2JGgiv3M69DbNLl3CtQsKGbUR84NhEW_bmXRJhn1yNp79h | |
| dc.identifier.uri | http://libra.omu.edu.tr/tezler/76552.pdf | |
| dc.identifier.uri | https://hdl.handle.net/20.500.12712/29056 | |
| dc.identifier.yoktezid | 298808 | |
| dc.language.iso | tr | en_US |
| dc.publisher | Ondokuz Mayıs Üniversitesi, Sağlık Bilimleri Enstitüsü | en_US |
| dc.relation.publicationcategory | Tez | en_US |
| dc.rights | info:eu-repo/semantics/openAccess | en_US |
| dc.subject | Genetik | |
| dc.subject | Parazitoloji | |
| dc.subject | Veteriner Hekimliği | |
| dc.subject | DNA | |
| dc.subject | Echinococcosis | |
| dc.subject | Moleküler Yapı | |
| dc.subject | Genetics | en_US |
| dc.subject | Parasitology | en_US |
| dc.subject | Parazit Hastalıkları-Hayvan | |
| dc.subject | Veterinary Medicine | en_US |
| dc.subject | DNA | en_US |
| dc.subject | Parazitoloji | |
| dc.subject | Echinococcosis | en_US |
| dc.subject | Molecular Structure | en_US |
| dc.subject | Polimeraz Zincirleme Reaksiyonu | |
| dc.subject | Parasitic Diseases-Animal | en_US |
| dc.subject | Parasitology | en_US |
| dc.subject | Prevalans | |
| dc.subject | Polymerase Chain Reaction | en_US |
| dc.subject | Prevalence | en_US |
| dc.subject | Taksonomi | |
| dc.subject | Taxonomy | en_US |
| dc.subject.other | TEZ DOK B573s 2011 | en_US |
| dc.title | Samsun Yöresi Mandalarda Kistik Ekinokokozisin Yaygınlığı, Suşların PZR ve DNA Dizi Analizi İle Tesbiti | |
| dc.title | Cystic Echinococcosis Prevalence in Samsun Region Buffaloes, Detection of Genotypes With PCR and DNA Sequence Analysis | en_US |
| dc.type | Doctoral Thesis | en_US |
| dspace.entity.type | Publication |
